That the Treasury Secretary has to go around reassuring people of the safety of their U.S. investments is not good. It's like hearing a pilot announce in mid-flight that the airplane is in perfect working order.

I suspect that by spending trillions to prop up companies and stimulate the economy, the U.S. has jumped out of the frying pan into the fire. As bad as this economic downturn is, it pales in comparison to U.S. federal bankruptcy.

When the communists laugh at the latte socialists you gotta know the shit ain't far from the fan.

Syncro

It is all part of the Obama plan. Once the US dollar achieves parity with the Mexican Peso, GM cars will be all Americans can afford. How did the Peso and Lira get so low anyway? Couldn't have been by following policies anything like Obamas, I am sure of that. Obama is very smart and would never lead us down such a path.

"Good evening ladies and germs."

"I just flew in from America, and boy are my tax payers tired."

"I had 2 chickens. One got sick, so I made chicken soup out of the other one to help the sick one get well."

Take my dollar,... please."

"Is this thing on?"

The mother of all put downs - being laughed at.

SDA gets results!

http://www.reuters.com/article/newsOne/idUSPEK14475620090601

"His answer drew loud laughter from his student audience, reflecting scepticism in China about the wisdom of a developing country accumulating a vast stockpile of foreign reserves instead of spending the money to raise living standards at home."

That's right, the editors have peered into the minds of the audience and have determined they were laughing because they're of the opinion China just isn't being socialist/protectionist enough...

Someday, someone will discover the missing gene code sequence - latte liberal fascism : aka moral hazard denial and the law of unintended consequences rejection syndrome

GATTATAACATTATAAAGGCATTAGAGCTA

Or both links might be more than a day old... Either way.

Hey Stricker......Not fast enough for ya hey?

Brilliant.

Syncro

"U.S. Treasury Secretary Timothy Geithner on Monday reaffirmed his faith in a strong dollar" -- as well as Santa Clause, the Easter Bunny and the Tooth Fairy.

If there's one thing of which the Chinese know the value, it's money. Let's hope His Obamaness has at least a passing familiarity with the term "hyperinflation". 'Though I won't hold my breath.

I can completely understand the Chinese students response I break out in laughter everytime Tiny Tim speaks because he is...well...how do you say this without being too judgmental ... an idiot!

"Chinese financial assets are very safe," Geithner said. His response drew laughter from the audience.

Was China one of the Chrysler bond holders that got shanked by the Obama fawning Supreme Court that put the UAW illegally in line ahead of the "secured" bondholders?
Maybe.

Nobody, and I mean nobody, should feel safe investing in the U.S. or feel their current investments in the U.S. are safe after that fiasco.

here something that should draw laughter too.
we will see that famous lieberal handshake soon, palm up.

http://www.ctv.ca/servlet/ArticleNews/story/CTVNews/20090602/AUTOS_stronach_emission_090602/20090602?s_name=Autos

Of course the Chinese are laughing - they just bought Hummer. (Where is there room for anyone to drive a Hummer in China?)

"This is your Captain speaking. There is nothing, absolutely nothing, to be worried about".

Yes, I'm sure tha will reassure all airline passengers over the Atlantic.

Fritz In their new territory the US of China.

How typical of the MSM: the most significant sentence in the article, in fact the only significant sentence, appears at the very end. The wonder is that it appeared at all.

Illiquid Assets: "...I break out in laughter everytime Tiny Tim speaks because he is...well...how do you say this without being too judgmental ... an idiot!

A beautiful sentence, Illiquid. At a literal level, I doubt its accuracy, but it's a very funny sentence nonetheless. I may use it the next time a putdown is required.

The trajectory of the excrement puts it in a direct path to the turbine blades (note, the referenced turbine blades are not wind generators, but rather cooling fans - I've yet to see more than 3/100 wind generation turbines actually moving).

I give Obama/Geitner 3 months tops before the dollar meltdown is manifested in hunger, significant civil unrest and crime - Argentina 2.0.

A little off in left field....

"Is there nothing that the Car-Salesman-in-Chief Can't Do?" link has an advert on the left to learn Chinese online with 'the best teachers'. Not only will they be driving Hummers in US of China, we will have kindly learned Chinese!

Kate, did you plan that? You are good!!

Heh.

My bad. To the right. To the right. I always get my left and right mixed up on Tuesdays!

Glen Beck brought this laugh item up on his show yesterday and feels the shame of his national leaders being laughed at.

He has also been talking in a daily series to Thomas Sowell about his book 'The Housing Boom and the Bust'.
Sowell tells it like it is naturally and names names.

And Beck also had the author of 'Liberal Fascism' on this week talking about the govt becoming involved in all aspects of business life in the USA.

This guy is hitting on all cylinders right now.

There must be something in the brain of “democrats” (sic) that causes them to go about begging against all odds and common sense in general, when they should know they are screwing things up. Sometimes it seem as though they are banging a brick wall with their big Harvard heads, all the while thinking the next bang will surely bring the wall down.
Some might remember prez Carter, when the oil rich countries cut down sale of oil to the US during his “democrat” (sic) administration, Carter, went scurrying about with his tail between his legs, to Mexico, begging for cheap oil. In many senses this current man in charge (?), seem to repeat much the same thing.
What gives?

The stranger in the White House has hired crooks like tax cheat Geithner for a reason - they can (and will be) blackmailed with their past if they do not say and do exactly what the Big 0's TORTAS tell them to say and do. Lenin and Stalin used such men, also, and this method combined with complete control over the press allowed these thugs to crush all decent mercilessly.

Living next door to this red monster is almost worse that living with the Liberanos in power. I am afraid for my American friends and I am afraid for us!

Jema:

Do you mean dissent?

Otherwise, sounds pretty close.

yep, destroying the u.s. economy and half the world with it, that's a real hardy har har.

Thanks for correcting my spelling error, set you free.